为您找到"
pcmv myc
"相关结果约100,000,000个
Vector for expressing an N-terminally Myc-tagged protein in mammalian cells. pCMV-Myc-N is identical but contains a complete Myc tag.
The pCMV vectors use the CMV promoter for constitutive, high-level expression in a wide variety of mammalian cells. The myc-tagged protein of interest can be detected by either Western blot analysis or fluorescence microscopy using an anti-myc antibody. The pCMV-Myc & pCMV-HA Vector Set (Cat. # 631604) includes c-Myc monoclonal and HA-Tag polyclonal antibodies, which can also be used in ...
CMV Cloning Method Unknown Size 3800 5' Sequencing 1 Primer pCMV 5' Sequencing 1 Primer Sequence 5'd [GATCCGGTACTAGAGGAACTGAAAAAC]3' Tag 1 Myc (N-term) (MASMQKLISEEDL) Bacterial Resistance Ampicillin Notes Vector for expressing an N-terminally Myc-tagged protein in mammalian cells. Catalog Number 631604 Stable Transient Constitutive ...
Provide pCMV-Myc vector/plasmid map, full length sequence, antibiotic resistance, size and other information
The pCMV-Myc Mammalian Expression Vector expresses proteins containing the N-terminal c-Myc epitope tag. The c-Myc epitope tag is well-characterized and highly immunoreactive.
Skip to the beginning of the images gallery SKU PS100006 pCMV6-AC-Myc-His, mammalian vector with C-terminal Myc-His tag, 10ug Be the first to review this product Datasheet SDS Vector Sequence $650.00
Agilent's pCMV-3Tag vector series is the advanced epitope tagging system in which three copies of either the FLAG or c-myc tags are added to your protein. FLAG and c-myc tags are small, highly immunoreactive, do not interfere with the function of your protein, and are easily detected with commercially available antibodies.
pCMV-Myc-N is a vector for inserting your gene of interest with a Myc tag. It has a human cytomegalovirus promoter, a SV40 splice site, a multiple cloning site, a SV40 polyA signal, a pUC origin of replication and an ampicillin resistance gene.
The pCMV-Myc Mammalian Expression Vector expresses proteins containing the N-terminal c-Myc epitope tag. The c-Myc epitope tag is well-characterized and highly immunoreactive.
The certificate of analysis for that lot of pCMV-Myc-S1P (87718) is not currently available online. Complete this form to request this certificate of analysis. To download a certificate of origin for pCMV-Myc-S1P (87718), enter the lot number exactly as it appears on your product label or packing slip.