为您找到"

pcmv myc

"相关结果约100,000,000个

pCMV-Myc Sequence and Map - SnapGene

Vector for expressing an N-terminally Myc-tagged protein in mammalian cells. pCMV-Myc-N is identical but contains a complete Myc tag.

Myc-tag and HA-tag vectors - Takara Bio

The pCMV vectors use the CMV promoter for constitutive, high-level expression in a wide variety of mammalian cells. The myc-tagged protein of interest can be detected by either Western blot analysis or fluorescence microscopy using an anti-myc antibody. The pCMV-Myc & pCMV-HA Vector Set (Cat. # 631604) includes c-Myc monoclonal and HA-Tag polyclonal antibodies, which can also be used in ...

Addgene: Vector Database - pCMV-Myc

CMV Cloning Method Unknown Size 3800 5' Sequencing 1 Primer pCMV 5' Sequencing 1 Primer Sequence 5'd [GATCCGGTACTAGAGGAACTGAAAAAC]3' Tag 1 Myc (N-term) (MASMQKLISEEDL) Bacterial Resistance Ampicillin Notes Vector for expressing an N-terminally Myc-tagged protein in mammalian cells. Catalog Number 631604 Stable Transient Constitutive ...

pCMV-Myc vector map and sequence

Provide pCMV-Myc vector/plasmid map, full length sequence, antibiotic resistance, size and other information

PDF pCMV-Myc - takara.co.kr

The pCMV-Myc Mammalian Expression Vector expresses proteins containing the N-terminal c-Myc epitope tag. The c-Myc epitope tag is well-characterized and highly immunoreactive.

pCMV6-AC-Myc-His Mammalian Expression Vector - OriGene

Skip to the beginning of the images gallery SKU PS100006 pCMV6-AC-Myc-His, mammalian vector with C-terminal Myc-His tag, 10ug Be the first to review this product Datasheet SDS Vector Sequence $650.00

Optimal expression of fusion proteins in mammalian cells | Agilent

Agilent's pCMV-3Tag vector series is the advanced epitope tagging system in which three copies of either the FLAG or c-myc tags are added to your protein. FLAG and c-myc tags are small, highly immunoreactive, do not interfere with the function of your protein, and are easily detected with commercially available antibodies.

PDF pCMV-Myc-N - Takara Bio

pCMV-Myc-N is a vector for inserting your gene of interest with a Myc tag. It has a human cytomegalovirus promoter, a SV40 splice site, a multiple cloning site, a SV40 polyA signal, a pUC origin of replication and an ampicillin resistance gene.

PDF pCMV-Myc - HonorGene

The pCMV-Myc Mammalian Expression Vector expresses proteins containing the N-terminal c-Myc epitope tag. The c-Myc epitope tag is well-characterized and highly immunoreactive.

pCMV-Myc-S1P - 87718 | ATCC

The certificate of analysis for that lot of pCMV-Myc-S1P (87718) is not currently available online. Complete this form to request this certificate of analysis. To download a certificate of origin for pCMV-Myc-S1P (87718), enter the lot number exactly as it appears on your product label or packing slip.

相关搜索